Comparative Study of 3D-Printed Porous Titanium Alloy with Rod Designs of Three Different Geometric Structures for Orthopaedic Implantation

doi:10.1007/s40195-023-01573-0

Abstract

Abstract:

Porous titanium alloy is currently widely used in clinical treatment of orthopaedic diseases for its lower elastic modulus and ability to integrate with bone tissue. At the micro-level, cells can respond to different geometries, and at the macro-level, the geometric design of implants will also affect the biological function of cells. In this study, three kinds of porous scaffolds with square, triangular and circle rod shapes were designed and 3D printed. This study observed the proliferation and differentiation of MC3T3-E1 cells during surface culture of the three types of scaffolds. It also evaluated the characteristics of the three scaffolds by means of compression tests and scanning electron microscopy to provide a reference for the design of porous titanium alloy implants for clinical applications. The trends of cell proliferation and gene expression between the three types of scaffolds were observed after treatment with two inhibitors. The results show that the square rod porous scaffolds have the best proliferative and osteogenic activities, and these findings may be due to differences in piezo-type mechanosensitive ion channel component 1 (Piezo1) and Yes-associated protein (YAP) expression caused by the macro-geometric topography.

Key words: Porous titanium scaffolds, Geometric morphology, Cell proliferation, Structural design

Jiaxin Li, Haozhang Zhong, Bojun Cao, Zhaoyang Ran, Jia Tan, Liang Deng, Yongqiang Hao, Jinglong Yan. Comparative Study of 3D-Printed Porous Titanium Alloy with Rod Designs of Three Different Geometric Structures for Orthopaedic Implantation[J]. Acta Metallurgica Sinica (English Letters), 2024, 37(1): 54-66.

Figures/Tables 11

Fig. 1 Schematic diagram of main research methods

Fig. 2 Preparation and characterization of porous scaffolds with different rod geometric designs: a-c design drawing display, d general picture of porous scaffold, e stress-strain curves of 3 kinds of scaffolds

Table 1 Primers used for quantitative RT-PCR analysis

Gene	Forward primer sequence (5′-3′)	Reverse primer sequence (3′-5′)
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
Notch1	GATGGCCTCAATGGGTACAAG	TCGTTGTTGTTGATGTCACAGT
YAP	GGCTCTAAAGAACCCGAACC	GCAGCTGAAGAAACCACCTC
Piezo 1	CACTGGCCCAGAGCTTCTAC	ATGTCTGTGGCTGCAGAGTG
Jag 1	TGCCTCTGTGAGACCAACTG	AGGGGTCAGAGAGACAAGCA
NF-KB	CTGACCTGAGCCTTCTGGAC	GCAGGCTATTGCTCATCACA

Fig. 3 Distribution of MC3T3-E1 cells on three scaffolds with different rod geometric structures (magnification 30×, 150× and 1000×)

Fig. 4 Cell proliferation and adhesion on the surface of scaffolds designed with three different rod geometric structures: a cell proliferation of scaffolds designed with three different rod geometric structures, b-d confocal laser scanning images of MC3T3-E1 cells on the scaffold surface with three different geometric rod designs

Fig. 5 Cell proliferation of scaffolds designed with the pore size control and surface area control of three different rod geometric structures: a cell proliferation of pore size control scaffolds designed with three different rod geometric design, b cell proliferation of surface area control scaffolds designed with three different rod geometric design

Fig. 6 Osteogenic activity of MC3T3-E1 cells on three scaffolds with different rod geometric structures: a alkaline phosphatase activity was different among different groups after 7 days of culture, b alkaline phosphatase activity was different among different groups after 14 days of culture, c alizarin red staining of MC3T3-E1 cells cultured on scaffolds with three different rod geometric designs, d semiquantitative detection of alizarin red

Fig. 7 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs: relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds

Fig. 8 Cell proliferation of scaffolds designed with the pore size control and surface area control of three different rod geometric structures after inhibitor: a cell proliferation of pore size control scaffolds designed with three different rod geometric designs after GsMTx4 treated, b cell proliferation of surface area control scaffolds designed with three different rod geometric designs after GsMTx4 treated, c cell proliferation of pore size control scaffolds designed with three different rod geometric designs after verteporfin treated, d cell proliferation of surface area control scaffolds designed with three different rod geometric designs after verteporfin treated

Fig. 9 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs after GsMTx4 treated: Relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds after GsMTx4 treated

Fig. 10 Relative gene expression levels of MC3T3-E1 cells cultured on scaffolds designed with rods of three different geometric designs after verteporfin treated: Relative gene expression levels of Piezo1, YAP, Notch1, Jag1 and NF-KB between three different scaffolds after verteporfin treated

References 48

[1]	C. Ma, T. Du, X. Niu, Y. Fan, Bone Res. 10, 59 (2022)
[2]	K. Choi, J.L. Kuhn, M.J. Ciarelli, S.A. Goldstein, J. Biomech. 23, 1103 (1990)
[3]	Y. Heriveaux, S. Le Cann, M. Fraulob, E. Vennat, V.H. Nguyen, G. Haiat, Med. Biol. Eng. Comput. 60, 3281 (2022)
[4]	P. Wang, F.H. Chen, J. Eckert, S. Pilz, K.G. Prashanth, J. Cent, South Univ. 28, 1068 (2021)
[5]	S.J. Yu, P. Wang, H.C. Li, R. Setchi, M.W. Wu, Z.Y. Liu, Z.W. Chen, S. Waqar, L.C. Zhang, Virtual Phys. Prototyp. 18, e2155197(2023)
[6]	R. Baptista, M. Guedes, J. Mech. Behav. Biomed. Mater. 117, 104378 (2021)
[7]	S. Arabnejad, R. Burnett Johnston, J.A. Pura, B. Singh, M. Tanzer, D. Pasini, Acta Biomater. 30, 345 (2016)
[8]	G. Li, L. Wang, W. Pan, F. Yang, W. Jiang, X. Wu, X. Kong, K. Dai, Y. Hao, Sci. Rep. 6, 34072 (2016)
[9]	C.M. Bidan, K.P. Kommareddy, M. Rumpler, P. Kollmannsberger, P. Fratzl, J.W. Dunlop, Adv. Healthc. Mater. 2, 186 (2013)
[10]	S.J.P. Callens, R.J.C. Uyttendaele, L.E. Fratila-Apachitei, A.A. Zadpoor, Biomaterials 232, 119739 (2020)
[11]	Q. Wang, Y. Huang, Z. Qian, J. Biomed. Nanotechnol. 14, 628(2018)
[12]	C. Hou, J. An, D. Zhao, X. Ma, W. Zhang, W. Zhao, M. Wu, Z.Zhang, F. Yuan, Front. Bioeng. Biotechnol. 10, 835008 (2022)
[13]	J.O. Abaricia, A.H. Shah, M. Chaubal, K.M. Hotchkiss, R. Olivares-Navarrete, Biomaterials 243, 119920 (2020)
[14]	S. Zhang, Y. Wang, B. Zhou, F. Meng, H. Zhang, S.J. Li, Q.M. Hu, L. Zhou, Acta Metall. Sin. -Engl. Lett. 36, 35 (2023)
[15]	D. Martinez-Marquez, Y. Delmar, S. Sun, R.A. Stewart, Materials (Basel) 13, 4794 (2020)
[16]	M. Alana, A. Lopez-Arancibia, S. Ghouse, N. Rodriguez-Florez, S. Ruiz de Galarreta, Comput. Biol. Med. 150, 105761 (2022)
[17]	J. Parthasarathy, B. Starly, S. Raman, A. Christensen, J. Mech. Behav. Biomed. Mater. 3, 249 (2010)
[18]	W.M. Peng, Y.F. Liu, X.F. Jiang, X.T. Dong, J. Jun, D.A. Baur, J.J. Xu, H. Pan, X. Xu, J. Zhejiang Univ. Sci. B 20, 647 (2019)
[19]	R. Thibeaux, H. Duval, B. Smaniotto, E. Vennat, D. Neron, B. David, Biotechnol. Prog. 35, 2880 (2019)
[20]	C.H. Seo, K. Furukawa, Y. Suzuki, N. Kasagi, T. Ichiki, T. Ushida, Macromol. Biosci. 11, 938 (2011)
[21]	Y. Sun, B. Wan, R. Wang, B. Zhang, P. Luo, D. Wang, J.J. Nie, D. Chen, X. Wu, Front. Cell Dev. Biol. 10, 808303 (2022)
[22]	W. Li, F. Dai, S. Zhang, F. Xu, Z. Xu, S. Liao, L. Zeng, L. Song, F. Ai, ACS Appl. Mater. Interfaces 14, 20693 (2022)
[23]	V. Karageorgiou, D. Kaplan, Biomaterials 26, 5474 (2005)
[24]	D.J. Lee, J. Kwon, Y.I. Kim, X. Wang, T.J. Wu, Y.T. Lee, S. Kim, P. Miguez, C.C. Ko, Orthod. Craniofac. Res. 22(Suppl 1), 127(2019)
[25]	S. Ehrig, B. Schamberger, C.M. Bidan, A. West, C. Jacobi, K. Lam, P. Kollmannsberger, A. Petersen, P. Tomancak, K. Kommareddy, F.D. Fischer, P. Fratzl, J.W.C. Dunlop, Sci. Adv. 5, 1(2019). https://doi.org/10.1126/sciadv.aav9394
[26]	M. Werner, N.A. Kurniawan, C.V.C. Bouten, Materials (Basel) 13, 963 (2020)
[27]	D. Martinez-Moreno, G. Jimenez, C. Chocarro-Wrona, E. Carrillo, E. Montanez, C. Galocha-Leon, B. Clares-Naveros, P. Galvez-Martin, G. Rus, J. de Vicente, J.A. Marchal, Mater. Sci. Eng. C Mater. Biol. Appl. 122, 111933 (2021)
[28]	J. Hu, S. Wang, B. Li, F. Li, Z. Luo, L. Liu, IEEE. Trans. Vis Comput. Graph. 28, 2615 (2022)
[29]	D.A. Muller, U. Silvan, Int. J. Dev. Biol. 63, 1 (2019)
[30]	K. Xie, Y. Guo, S. Zhao, L. Wang, J. Wu, J. Tan, Y. Yang, W. Wu, W. Jiang, Y. Hao, Clin. Orthop. Relat. Res. 477, 2772 (2019)
[31]	K.A. DeMali, X. Sun, G.A. Bui, Biochemistry 53, 7706 (2014)
[32]	M. Paris, A. Gotz, I. Hettrich, C.M. Bidan, J.W.C. Dunlop, H. Razi, I. Zizak, D.W. Hutmacher, P. Fratzl, G.N. Duda, W. Wagermaier, A. Cipitria, Acta Biomater. 60, 64 (2017)
[33]	S.M. Yu, J.M. Oh, J. Lee, W. Lee-Kwon, W. Jung, F. Amblard, S. Granick, Y.K. Cho, Acta Biomater. 77, 311 (2018)
[34]	X.Z. Fang, T. Zhou, J.Q. Xu, Y.X. Wang, M.M. Sun, Y.J. He, S.W. Pan, W. Xiong, Z.K. Peng, X.H. Gao, Y. Shang, Cell Biosci. 11, 13 (2021)
[35]	J.L. Yu, H.Y. Liao, Biomed. Pharmacother. 140, 111692 (2021)
[36]	Y. Jiang, X. Yang, J. Jiang, B. Xiao, Trends Biochem. Sci. 46, 472(2021)
[37]	A.H. Lewis, J. Grandl, Elife 4, 12088 (2015)
[38]	M. Fu, Y. Hu, T. Lan, K.L. Guan, T. Luo, M. Luo, Signal Transduct. Target. Ther. 7, 376 (2022)
[39]	M. Aragona, T. Panciera, A. Manfrin, S. Giulitti, F. Michielin, N. Elvassore, S. Dupont, S. Piccolo, Cell 154, 1047 (2013)
[40]	W.B. Swanson, M. Omi, S.M. Woodbury, L.M. Douglas, M. Eberle, P.X. Ma, N.E. Hatch, Y. Mishina, Int. J. Mol. Sci. 23, 4499 (2022)
[41]	M. Yoneda, H. Suzuki, N. Hatano, S. Nakano, Y. Muraki, K. Miyazawa, S. Goto, K. Muraki, Int. J. Mol. Sci. 20, 4960 (2019)
[42]	K. Hasegawa, S. Fujii, S. Matsumoto, Y. Tajiri, A. Kikuchi, T. Kiyoshima, J. Pathol. 253, 80 (2021)
[43]	Y. Liu, Q. Yang, Y. Wang, M. Lin, Y. Tong, H. Huang, C. Yang, J. Wu, B. Tang, J. Bai, C. Liu, A.C.S. Biomater, Sci. Eng. 8, 3498(2022)
[44]	L. Li, S. Yang, L. Xu, Y. Li, Y. Fu, H. Zhang, J. Song, Acta Biomater. 96, 674 (2019)
[45]	C. Bae, F. Sachs, P.A. Gottlieb, Biochemistry 50, 6295 (2011)
[46]	K. Vigneswaran, N.H. Boyd, S.Y. Oh, S. Lallani, A. Boucher, S.G. Neill, J.J. Olson, R.D. Read, Clin. Cancer Res. 27, 1553 (2021)
[47]	H. Wei, F. Wang, Y. Wang, T. Li, P. Xiu, J. Zhong, X. Sun, J. Li, Cancer Sci. 108, 478 (2017)
[48]	Y. Xu, L. Li, Y. Tang, J. Yang, Y. Jin, C. Ma, Eur. J. Pharmacol. 865, 172794 (2019)